Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710D9
Clone ID IST14710D9
Vector VICTR76
Project tigm

Sequence tag IST14710D9HMR1
Sequence
TGCCNATGTTCAAGAGTTTGACTTTTGGGCATCTGTTCTGGAAAACCCATCTTTTANGTTTTTTTCTGTCATTTTTGTCT
T
Sequence Type genomic DNA
Unitrap ID UNI12431

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45709008..45709088 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023944 (Hsp90ab1) NM_008302 heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene [Source:MGI (curated);Acc:Hsp90ab1-001]


Sequence tag IST14710D9HMF1
Sequence
GGCATGTTCAGTGCATAGCTCACTGACTCTGAACAGAACACCTGGCAATATGGTAAAAATCCAGACTAAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45709085..45709159 75
 
EST/CDNA Est Name
  BF149958.1


Sequence tag IST14710D9BBF1
Sequence
GGCATGTTCAGTGCATAGCTCACTGACTCTGAACAGAACACCTGGCAATATGGTAAAAATCCAGACTAAGTTAACAATAC
ATAAAAAAGAACCTCAAGCAACCCCTGGTACTCACACCCCTTAACTACAATCTCCTCATTGGGGTGAGGAACAACTTTAA
CAGAAAAAGCAGTCTTTTTTAATTTTTATTTTATTCCACCCAGCAGGGCAAGAGAACCTTGAAGCTGTAGTCTGGGAGGC
GCTCACGGGGCAATTAAATCAGGACAAAGAAATCAAGAGCTCCACCGTGACCNCTCACTGTGCANACTTGCATAGGCCGG
AACCCAANTNAAATGGTGNCCCANCCNTCCNACNACCCTCNTCACTGNCGGANATGCNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45709085..45709464 354
 
EST/CDNA Est Name
  BY666984.1 - BY662141.1 - BY406077.1 - BG293379.1 - BY680894.1 - BY675232.1 - BY672539.1 - AA060648.1 - AA764415.1 - AA855193.1 - CN682484.1 - AW475255.1 - BQ896003.1 - BE692766.1 - DT904144.1 - CN677015.1 - CF725591.1 - CA540167.1 - AI931579.1 - CF724043

 
Come back to gene BY666984.1 - BY662141.1 - BY406077.1 - BG293379.1 - BY680894.1 - BY675232.1 - BY672539.1 - AA060648.1 - AA764415.1 - AA855193.1 - CN682484.1 - AW475255.1 - BQ896003.1 - BE692766.1 - DT904144.1 - CN677015.1 - CF725591.1 - CA540167.1 - AI931579.1 - CF724043


For any suggestions or comments, please send an email to unitrap@crg.es