Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14930D12
Clone ID IST14930D12
Vector VICTR76
Project tigm

Sequence tag IST14930D12HMF1
Sequence
TCACTTACCTGAGAAACGTTGATGCTCATATTCTTACTTCAACTACCAATACACCAGACAGAAATATGATTAGAAATATT
TTTTACTAGTTTCTGAAAAGTAAGTTCTGAAAATTAATCCCACTGCCCCAGAAAGCAAGGCTCATTTTAGAAGAGGGAGG
AATCTTTTCCAGTGGAGCCATGGTGTGAGTATTAGGCTTCACCAAAATGTTGATTGCAGTTGTTTTCCCATGAGAGACAT
TCACAACTTTAGCTTGAATGGGGATAATGAATACTCTTCTCCTTGTTTCCTAGTCCATATGTGGTTGAGCTGTGTGCACA
CATGAAAACTCTGGGAAATGAACTGCCTGCCCTGCATGTCTGCCTGGGATACCCCCAGTTTTNACTTATTCCCTCTTATT
GAGACTGTTAGTCCTGACCTANTTAGCTGCATTANTTATTCNCTGTTAGATCACAGCATGGANTCNTTGAANTGATACTT
NNNGTCANCGTCACTTCNTTCCNCNNTGNAA
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18138758..18139259 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]


Sequence tag IST14930D12HMR1
Sequence
GTGATGTGAGCCCTGCTTGGTCNCAGTCNTTTAAAGCAATTCATGTCTCAGACACTGGGATGGGACCAAGGTCACATGAG
TCAAAGGAACACGTGGGGCAGGGGGGAATATCCTCCCTCCAGCCTCACAAAGAAAGAACTAGTACACAAAACAATACACA
CCATCTCAAAATCCTCTTATAAGGCAGCCAGACATAGAATCCTAAGGTCAGGCAACATTCAGGTAAACANNCTNNNGAAG
CTAAAAAAGAAGAAGAAAANNNNNTCNTTTCANACNTNTTTTTATTCTCAGAATTGAGTGTGTTGATTAAGCAATANANT
GACTGTAAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039835


For any suggestions or comments, please send an email to unitrap@crg.es