Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10235E3
Clone ID IST10235E3
Vector VICTR76
Project tigm

Sequence tag IST10235E3BBF1
Sequence
GTTTCATGCATAATAATGCATGCATACGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCTGACTGCTCTCCGAAGGTC
TGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATGTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98514417..98514530 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017211 (Gsdma2) NM_029727 gasdermin A2 Gene [Source:MGI (curated);Acc:Gsdma2-002]

 
Come back to gene ENSMUSG00000017211


For any suggestions or comments, please send an email to unitrap@crg.es