Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10107G2
Clone ID IST10107G2
Vector VICTR76
Project tigm

Sequence tag IST10107G2HMF1
Sequence
GGGGTAATTATTCCACCACAGGCTCATGTCATCTTTTACCTGTGGATCTTCCNATTTCCCCCAAGTTGGTTCTAAGTGTA
AGCACTGTCAAATAAGTTCTACGGGTATTTTGTGAACTCTCTATCTCATTAACATATCTGTCATTTTAATTCAGATTTTG
CCACGGCACTCTGGTTGAGTCAGCCTGTCGGGCAGGGATGCCTAAAAGCTGCTCATGAAGCAAAAAGAGTTTCACAGAAA
CTCGCTCCTGGAGTCTGACGTGCTCTCTAAATTTTCCATTCCCACGTTAGTCTAGTGGATGGATCCNCGTGCTCTCTTTA
TTATAAGTGCCTTTTAANATTGAATTCTGACATAGCTNAAGCCTTCCGCCAGTGTTCCNACAGTCCTAGAACGTCCTTGA
NCTAGACAGTGACATTCANAATAGCCTCTGGTATNACACTATCNATAAAAGCCNAGTGCTCCCATATACANGAATTTACA
ANGGTTTNNGAAGTAGATCGGGCTGTGGTTTNANANTATTGCATNATTCATGAGANGGNNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103968781..103969318 500
 
EST/CDNA Est Name
  BF018662.1


Sequence tag IST10107G2BBR1
Sequence
CCCTATGAAATACAACTTTCTGTAAGGAAATTGCCAAGCAGGCTGTGGGCCTGCCTCAATAAGTGGAGTGCCCCCAAGCA
TGCATGAAACTAGGGTCAATCCCCAGGGCCATATAAACCAGGAATAGTTTGTGATGGTATGTGTCATTTTAGCACTTGGG
AGATAGAGGTAATAATATTAGAAGCTCAAAGTTGTCCTTGAACAACTTCACAAAATTGTTCTCTAATTTCCTTATGCATA
TGGTGGTATGCATGTTCACACATGTGCACACACTATATGTGTGTGTAGGTGTGTATGTGTAAATACATATATGTATTATG
TGTATGCATACACACATATACACATAAATATATGCATATATGTACACATATATATATATACACATATATATAATCCCCAG
CATTGGTTAGGATATGAAACATTAAGTCTTATTAAGGTATAGGTCTGTATAGTAACCATTTACCAACACTTGACATTATC
CTGTAAAACTGAGATCAGAAAGATATGTGTGTCTCTTGCCTCAGAAATATTTTTCCTTTTTTTTTCCCATTTAAAAACAT
TTATTTTCAGAAGAGGAAATTGAGAGC
Sequence Type genomic DNA
Unitrap ID UNI35853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103969316..103969899 573
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032558 (Acad11) NM_175324 nephronophthisis 3 (adolescent) Gene [Source:MGI (curated);Acc:Nphp3-001]


Sequence tag IST10107G2BBF1
Sequence
GGGGTAATTAATCCACCACAGGCTCATGTCATCTTTTACCTGTGGATCTTCAATTTCCCCCAAGTTGGTTCTAAGTGTAA
GCACTGTCAAATAAGTTCTACGGGTATTTTGTGAACTCTCTATCTCATTAACATATCTGTCATTTTAATTCAAATTTTGC
CACGGCACTCTGGTTGAGTCAGCCTGTCGGGCAGGGTTGCCTAATTGCTGCTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103969105..103969318 200
NO GENE  

 
Come back to gene ENSMUSG00000032558


For any suggestions or comments, please send an email to unitrap@crg.es