Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11764H3
Clone ID IST11764H3
Vector VICTR76
Project tigm

Sequence tag IST11764H3BBF1
Sequence
CTCCNANNGNTAGGGGACCCAGTACATGTGTTAGGAGTGTGTAGGGGCTCTTTTGTTATAGGTGTGAGTATGTGGCACAT
GTGTGCTGTGCCTGCATAGGCCAGGAGAGGATGCTCCATCTCTTGTAACTGGAGTTATAGGCAGTTGTGAGTTGTTTGAG
GAGGATGCTGGGTTATCTTCATTGGTGTTTTGCCTGAATGTATGTCTGGATGACAGAAGCCCTAGAACTGGAGCTACTGA
CAGGTGTGAGGTGTCATTGGTTGCTGGGAATTGAATCCAGGTCCTCTGGAAGAGCAGCCAGTGCTTTTGATTTTTTAATA
CAGGGTTTCTCTGTGTAACAGTCCTGGGAGTCCTGGAACTCACTTTGTAGACCAGGCTGGCACTGAACTCACAGGGTCCC
CACCTGCCTCTGCCTCCTGCATGCTGGGATTAAAGGTGGGGGCCNTCACACCTGGTCACAANNNNNNNCATTCTTAACTC
GTGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI2404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111234745..111235233 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029512 (Ulk1) NM_009469 Unc-51 like kinase 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1270126]

 
Come back to gene ENSMUSG00000029512


For any suggestions or comments, please send an email to unitrap@crg.es