Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14407F12
Clone ID IST14407F12
Vector VICTR74
Project tigm

Sequence tag IST14407F12BBF1
Sequence
ATACTCTTGATTGCAAAGCCTCAAGGGCTAAAATTTCCTTGAAAGAAATTCAAGTAAGTCTTAAGTAAGCCTTTTGTTTT
GTTTATAATAAACTAAACTTGTTTGCTTTGATCAACATGAAAACCAGTACTTCTTTTAGTAGAAGCTGGAGTCTTTAGAT
AAGATTTTTTTAAATTGCTATTCTATGTGGAGATTTTTGTGGTGACAGACTGAGACCCAACAGTGCTATCTAGATTCTTG
AAAACAGTGAGATTTCAAGTCAAGTCCCTTATGACATGAAAGAATGCGAGGAATGCGAGGAATCAGGGAAGTANGCCACG
GTTTAAAGTATTACACTGGCCAGAGAAAGCTTCNCANGCAGTCTCTCTGANCNCTGGAACCCAGCAGATCCCTCTCCCAG
AATGCTGCCNTCNTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6063834..6064259 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST14407F12HMR1
Sequence
ATGTGTGTANAAAANNNAACCAACCTGGGTTTTGTTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14407F12HMF1
Sequence
ATACTCTTGATTGCAAAGCCTCAAGGGCTAAAATTTCCTTGAAAGAAATTCAAGTAAGTCTTAAGTAAGCCTTTTGTTTT
GTTTATAATAAACTAAACTTGTTTGCTTTGATCAACATGAAAACCAGTACTTCTTTTAGTAGAAGCTGGAGTCTTTAGAT
AAGATTTTTTTAAATTGCTATTCTATGTGGAGATTTTTGTGGTGACAGACTGAGACCCAACAGTGCTATCTAGATTCTTG
AAAACAGTGAGATTTCAAGTCAAGTCCCTTATGACATGAAAGAATGCGAGGAATGCGAGGAATCAGGGAAGTAGGCCACG
GTTTAAAGTATTACACTGGCCNGC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6063919..6064259 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es