Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST458838
Clone ID OST458838
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST458838
Sequence
CAAGCCTACAACGAGGAACTAAAGAAGCTGGAATTACTCAGACAGAATGCTATTCGCAGTTGCCCGGGACTTTGAGGGCT
GCAGTGTTCTTCGAAAGTACCTTGGCCAGCTACACTACCTACAGAGTCGGGTGCCCATGGGCTCAGGCCAGGAGGCTGCT
GTAGCTGTCACCTGGACTGAGATCTTCTCGGGCAAGTCTGTGTCCCATGAAGACATNAAGNACGAGCAGGCCTGTATTCT
CTACAACCTCGGNGCACTGNACTCCATGCTGGGGGCTATGGACAAGCGGATGTCTGAGGAGGNCATGAAAGTTCTCCTGC
ACCCACTTCCAGNGTGCANCANGCGCCTTTGCCTACCTGCGTGAACACTTTCCACAGGCCTTCANNGTGGACATGAGTTN
GCCAGATCCTTACGCTCA
Sequence Type mRNA
Unitrap ID UNI2754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110295006..110300668 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036057 (Ptpn23) NM_001081043 protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]

 
Come back to gene ENSMUSG00000036057


For any suggestions or comments, please send an email to unitrap@crg.es