Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12974B12
Clone ID IST12974B12
Vector VICTR76
Project tigm

Sequence tag IST12974B12BBF1
Sequence
TAGGAAAGAAGGACTCGTGGGAAGGACTTTAATACTGGGAGAGTCTGAGCAGCAGGGCTGTGTTCCTGAGTGGCTCTCAN
TACAAAGACCACTTGAGAACGGAAAGCCAGCGTTACTTCTTGCTTATTCTTTTTAAGTCTTTGAATAAACATAATGGAAG
AAGCTGAAAATCGCTTTAAGGAAGTACCACTACCGTGTGCCTTGATTATGTGTGGCGGCCTTANTATTCATTTTGTAAAG
CCNGGAGTTTCTTTCTGCTCTGANCTCACTCTTTTGANACAGGGCCTTGCANTGTTGTTAAGGGTANCCTTGAACTTACN
ATCTTCCTCAGTTTACAGAGATGCTGGGGTTACAGGTGTGTTCCTACCACACCCACTCGAAAATCCTAATTTTAAAAGGT
TTATTTATTTCATGGCTGTTTTGCCTACCTGCNTGTNCATGACCCCGTGTGCATGGCTGGTGCCNNCACN
Sequence Type genomic DNA
Unitrap ID UNI18522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67363148..67363615 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031605 (Klhl2) NP_848748 kelch-like 2, Mayven (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924363]

 
Come back to gene ENSMUSG00000031605


For any suggestions or comments, please send an email to unitrap@crg.es