Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11477E4
Clone ID IST11477E4
Vector VICTR76
Project tigm

Sequence tag IST11477E4BBF1
Sequence
GTCACCACCTCCAAGGGTTGGGATTACAGGCTTGCACCATCACACCTGGCTTTTTGTTTGTGTTTCTTAAAAAAGTCTCC
ATAATTTGTTTTTGTAGAGATTCCCCATTTCTTTTCCGTTGCCCTGCTCCTCCTGTGCCACCCCACTCCCAGCTGTCCCT
TTTGCTTTTATGTCACATGTATTCTGTTACACTGCCCACTTCCTCAAAACCTTTTCCCCTCCAACGGTCCCTTTTCTAGT
TTCATGACCTATACCCATATATATNAAANGTANGTTCCACATATGAAAGANAATATGTGGTATTTGTCTTTTCTGTTTTT
CTGAATCTGGACTATGTCACAGCATGCATCCTACAAACTCTCAATTTANNATCANTCNTACNGTCTGCCTTCTGTGATCT
TATATCCTGANAGTTGAATGGCTATATCTTGTAAATGAATGGAGGCTGANGCCNTGAATGTATGGCTCTTGTGTCNNAN
Sequence Type genomic DNA
Unitrap ID UNI30521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34383256..34383730 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]


Sequence tag IST11477E4HMF1
Sequence
GTCACCACCTCCAAGGGTTGGGATTACAGGCTTGCACCATCACACCTGGCTTTTTGTTTGTGTTTCTTAAAAAAGTCTCC
ATAATTTGTTTTTGTAGAGATTCCCCATTTCTTTTCCGTTGCCCTGCTCCTCCTGTGCCACCCCACTCCCAGCTGTCCCT
TTTGCTTTTATGTCACATGTATTCTGTTACACTGCCCACTTCCTCAAAACCTTTTCCCCTCCNACGGTCCCTTTTCTAGT
TTNATGACCTATACCCATATATATNAAANGTANGTTCCACATATGAAAGANANTATGTGGTATTTGTCTTTTCTGTTTTT
CTGAATCTGGNCTATGTCACANCATGCATCCTACAAACTCTCAATTTANAATCANTCNTACAGTCTGCCTTCTGTGATCT
TATATCCTGANAGTTNAATGGCTATATCTTGNAAATGAATGGAGGCTGANGCCATGAATGTATGGCTCTTGNGTCNNANA
N
Sequence Type genomic DNA
Unitrap ID UNI30521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34383256..34383730 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es