Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14941B6
Clone ID IST14941B6
Vector VICTR76
Project tigm

Sequence tag IST14941B6BBF1
Sequence
GCGCCACTGCTGCACAGCACAAGAGTATCTGAAGAGGCTGAATGGGGGTAAGGCTGTTTTACAGACTGGATGGTTTTAGT
ATATATATTCTATATGAAAACAGATCGAACTTTTGAGCTGGCAGGTAGAAGGCAACTCTGCCGAATACTAGAGTAAAAGC
CCCCCATTTAGTGCACAGATCCACCCCTTCCGTCTGCATGCACGACACATTAACAGTATTTAAAGGTAAACGAGGCACTT
G
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727481..97727718 234
 
EST/CDNA Est Name
  BE634763.1 - BG094089.1 - BX632217.1 - AI465228.1 - BP761386.1 - BI438069.1 - R75588.1 - BE648949.1 - BE861138.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897415..32897652 234
 
EST/CDNA Est Name
  BE861138.1 - BE648949.1 - BP761386.1 - BI438069.1 - R75588.1 - AI465228.1


Sequence tag IST14941B6HMR1
Sequence
GCGCTGTGTGTAAATGCTATGCACTGAGGATACACAAATATGACGTGTACAGGATAATGCCTCATACNAATCAGATGTCC
ATTTGTTACTGTGTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897651..32897749 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66347589..66347687 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727384..97727482 95
NO GENE  

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es