Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11467A9
Clone ID IST11467A9
Vector VICTR76
Project tigm

Sequence tag IST11467A9BBF1
Sequence
NCTTTACATGCATAGGTGTTTTGCCTGCGTGTATGGCTGTGCACCATGTACATGCCTGGTTCCCTTGGAGTCTAGATGAT
ANCATCAGATNANTGAACCACCATGGGGGTGGCAGGAATGAAACCTGCATCCTCCTANAACAGCCATTCTNTTAACTGCT
GANCCATCTCTCCANCCCCACAACTGGTTCTCACATACATTCTNTTATNANTTATTACCTTCAATGCATTCTTTAATTTC
TNNNTGCTCGGGAATCCTTACTTATAACTAGNTAAGGTCTATCTNTNNNGGTCACGTGACNNNTAANTGAAAATATATGC
NAATAAACATCACTTATGCAAGANCCTGANTGCAACAAGTACTTTGCACATAANGTTNAANAATTCTAGAAACTCATCTN
ATTNANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11467A9HMR1
Sequence
GCAAAATAAATAGATCTTAAGGGAAAACAAAACAAAACATTGTGATGACGCATAGCTGTAGGTATGATGCTTCAGAGATG
CGGAGGCAGAAGGATGGGACGGACGTTCAAGGTCTTTTAAGATGTGGTGACACATGCTTTTAATCCCAGCATTCCATACC
AGAGGTGGGTGTATCTCTGTGGATCTGAGGCCCACCTGATCTACATAGAGAGTTCCAGGTCAGCCAGGATGACACAGTGG
CACACACACACACACACACACACACACACACACACACACNCN
Sequence Type genomic DNA
Unitrap ID UNI8511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72252041..72252319 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es