Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST458596
Clone ID OST458596
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST458596
Sequence
AGGTTTTACCCCCGTCGTGCATCCACACGAGTGCTTNTCTTGACATTTCTCGCAAATGGGAGAAGAAGAATAAGATTGTT
TACCCACCTCAACTGCCTGGCGAACCTTGGAGACCAGCGGAAATTTACCATTGTCGGAGACAAATAAAATACAGCAAGGA
CAAGATGTGGTACCTGGCAAAGATGATACGAGGCATGTCCATTGATCAGGCTTTGGCGCANCTGGAGTTCAATGATAAAA
AGGGGGCTCAAATNATTAAAGAGGTTCTNTTAGAAGCACAAGACATGGCAGTGAGAGACCATAATGNGGAATTTAGATNC
AACTTACACATANNTNAGTTTACCTNANGCCGAGGCCANCNGCCCTGAAGCGCATTCGTTACCATGGCCGAGGTC
Sequence Type mRNA
Unitrap ID UNI16553

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57986535..57992839 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020514 (Mrpl22) NM_175001 mitochondrial ribosomal protein L22 Gene [Source:MGI (curated);Acc:Mrpl22-001]

 
Come back to gene ENSMUSG00000020514


For any suggestions or comments, please send an email to unitrap@crg.es