Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11444E5
Clone ID IST11444E5
Vector VICTR76
Project tigm

Sequence tag IST11444E5BBF1
Sequence
CCCTGTGCACCACATGTGTGCCTGAAACCTATTGGAGGCCNNAAGAGGGCGTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29741030..29741086 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042203 (Tbc1d22b) NM_198647 TBC1 domain family, member 22B Gene [Source:MGI Symbol;Acc:MGI:2681867]


Sequence tag IST11444E5HMF1
Sequence
CCCTGTGCACCACATGTGTGCCTGAAACCTATTGGAGGCCANAAGAGGGCGTTGGATCCCCAGGAACTGGAGTTACATGG
TTTTAAGTCCCTATGGGGGTACTCGGGGGTACTGTCGATCGAATCCAGATCTTCTGGGAGAATAGCAGGAGTCTCANCAT
GCCTCCAGCTCACACTGTCTCTTGACNNGCGCACCATTTANGTGAGGCTGGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI32913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29741030..29741243 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042203 (Tbc1d22b) NM_198647 TBC1 domain family, member 22B Gene [Source:MGI Symbol;Acc:MGI:2681867]

 
Come back to gene ENSMUSG00000042203


For any suggestions or comments, please send an email to unitrap@crg.es