Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST458531
Clone ID OST458531
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST458531
Sequence
TGTGTTGCCCAGTCACGTGACTGAAGAGATGCTGTGGGAATGTAAGCAGCTTGGGGCACATTCCCCTTCCACACTGCTGA
CCACCCTCATGTTCTTTAACACCAAGTACTTCCTGTTGAAGACTGTAGATCAGCACATGAAGCTGGCTTTCTCTAAGGTC
CTCCGACAGACAAAGAAGAGCCCCTCGAATCCTAAGGATAAAAGCACGAGCATCCGCTACCTGAAGGCCCTCGGAATACA
CCAGACTGGCCAGAAAGTTACAGATGACATGTATGCAGAGCAAACAGAGAATCCAGAGAATCCACTAAGGTGTCCCATCA
AGCTCTACGATTTCTACCTCTTTAAATGCCCTCAGAGTGTGAAAGGCCGAAATGACACCTTTTACCTGACACCTGAGCCA
GTTGTAGCTCCCAACAGCCCAATCTGGTACTCAGTCCAGCCTATCAGCAGAGAACAGATGGGACAGATGCTGACCCGGAT
CCTGGTTATACGAG
Sequence Type mRNA
Unitrap ID UNI15998

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108458297..108461722 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es