Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11260H9
Clone ID IST11260H9
Vector VICTR76
Project tigm

Sequence tag IST11260H9HMF1
Sequence
CCAGCAAGAAAGGGCCTANGCTTCAATANCTTTANGCTACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11260H9HMR1
Sequence
AATGACCTCTTGCTTGGTGCCNAGATTGATACTGAGAATGTAGGAGAGAATAGAGCAGAATCCATTCATATGTAACACCC
TTAGCAGAGTAGCAGGGAAGACTTGGTAAAGTTCTTTTGGTTGGGAGTACCTGCAAGAGGGAATCTCTTTCAGTTCCAAA
ATGGCTGTGTGTAAGCTGCCAATGTAATCTCCATGGGTTTTCATTCTAAAATAGTGTCATATCACCNATCANATTTGCAA
TGAACTGTGTTCAGATTAAGACTAGTCTGCTATGTATTTNNCGTGTGTATGTTCGTGTGN
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722550..69722849 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es