Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10456D10
Clone ID IST10456D10
Vector VICTR76
Project tigm

Sequence tag IST10456D10HMR1
Sequence
TTCCATACACATACAGCCCTCCCTTCTCTCTGCTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI31406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133837842..133837886 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059772 (Giyd2) NM_029420 GIY-YIG domain containing 2 Gene [Source:MGI (curated);Acc:Giyd2-001]


Sequence tag IST10456D10BBF1
Sequence
TTAGAGAGAACAAGCTAGACACCGGTGAANACAAAAGGAGCCAGAGAATGAGAAGGAGCCAGAAGATTAGAACAGATTGT
CAAGGCTAGTATGAGGCCAAGCAGAGCAATTCAGTCAAAAGCTGAGAGAAGCCGGATTGAATCAGCCATCTTGGAAGAAT
AGATTGTACAGAGGTTAGAAGCTTCCAGGGGTAGGCCTAGGGATAGTTAGAACAGAGAAAGAAACGCTCTGGCTCAGCCC
AAGCCATATATTCACACAGCTTGGGTACGGCTCTCCTCTCANCCCTTCATCTGAGGAGATGAAAGCACATTCACATGGNA
GTGTAAGCCNAATAAACGCGTTCCTCCCCAGTACGCTTTCGGTCCTGGTGACTCATCACAACAATAGTAACAATAGTAAC
AATAGTAACCCTANGGGGCTGCAGANATGGCTCAGANGTTGAGAGCACTGACTGCTCTTCCAGANGTCATGAGTTNNACT
CCCAGCCNCCACGTGCTGGCCCACAACCATCTGCGATGCATACAATTCCCTNNNCTGGCGTGTCTNNNGGCAGCTNCACT
GNACTCATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133837920..133838487 530
 
EST/CDNA Est Name
  CB193454.1 - BQ714466.1 - CX202422.1 - CX212616.1 - CK796296.1 - BB665627.1 - CN677513.1 - CF622762.1 - BB651670.1 - CJ064410.1 - BE570880.1 - BM502937.1 - BU583639.1 - AL362894.1 - BG296108.1 - BY015243.1 - BY078731.1 - BY205674.1 - BY080113.1 - BY085114

 
Come back to gene CB193454.1 - BQ714466.1 - CX202422.1 - CX212616.1 - CK796296.1 - BB665627.1 - CN677513.1 - CF622762.1 - BB651670.1 - CJ064410.1 - BE570880.1 - BM502937.1 - BU583639.1 - AL362894.1 - BG296108.1 - BY015243.1 - BY078731.1 - BY205674.1 - BY080113.1 - BY085114


For any suggestions or comments, please send an email to unitrap@crg.es