Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12230F8
Clone ID IST12230F8
Vector VICTR76
Project tigm

Sequence tag IST12230F8HMF1
Sequence
TTTCTTTTTCTCCTCACTATTTGCAGGAATTGCAAAAAGTGACTCATGCTGACTTTGACAAGAGCTATGTCATGACATCA
TTCCGCCTGGCTTGTGTGTTATTATAGTAGTCCCTGTCTTGTGTGTCTAGCTGACTGTGCACTGCCTAGCTCTTGCTGTT
GCTAAGTGTCTGTCTCTGGGTATTTGGAGAGAGGATGGGTCATGTCGTTCTCAACAACTCCTGATGTATAATTATTAAAA
CTCCTGTAGTCACAGTTAAA
Sequence Type genomic DNA
Unitrap ID UNI30690

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 11997451..11997709 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021313 (Ryr2) NP_076357 ryanodine receptor 2, cardiac Gene [Source:MGI Symbol;Acc:MGI:99685]


Sequence tag IST12230F8BBF2
Sequence
ATAGTACAAAAGAAAAAGAATGGCTAGCAGTTGGGAAGTTGTTGCTGGCTGGCAAATATAGTAGCAAAAAAGAGTCTTCT
CTTATTATTCTGCTTGGGGGGGGGTGAGGAAATCGTTCACTGGTGTCAGTACGCTTTCGGGGTANCACTGGGCACTGCGC
ACATGTGCCTGCTATACTTTTTCTGGCCCTAGGAAAAGTACGGGCTTATTTGCCTTGTNNCAAATAANACAGATGANAAA
ATAANGGGTACAGGAANTAAGGGTGTTTACTTTTCAAANTTGCCCCACANTNCCGTTTAACAN
Sequence Type genomic DNA
Unitrap ID UNI13547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86400965..86401266 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es