Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10177E7
Clone ID IST10177E7
Vector VICTR76
Project tigm

Sequence tag IST10177E7BBF1
Sequence
AGGATTGTTCTCATTCTTGGGCACCANGGAGGGGATCTGTATGTTGCCCCTCAAGATGGCTCCTGCCGGAGTCCTCTGAT
CACAGAAGGCCAAATGGGATTCCTGGCCTCTGCTGACTTGCCAGACAGAGCAGATACTGTCTCATCAATGCCGGGGCAGG
ACGGGAGGTTTTGGAGAGCTGTGGGCCATACGGCCTTTCTGTCTTGCGGANCCTTGGGCTCACCCTGTGGTTAGGACTGC
TGTCTCATCGCTGTGACTGGCTTACTTACCTTTTGGGTAAGGCTTCTCTACCCATCCCCAGCCAGTGAGCTCCAGCTGGA
TCT
Sequence Type genomic DNA
Unitrap ID UNI29696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 76887877..76888198 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022010 (Tsc22d1) NM_009366 TSC22 domain family, member 1 Gene [Source:MGI (curated);Acc:Tsc22d1-006]

 
Come back to gene ENSMUSG00000022010


For any suggestions or comments, please send an email to unitrap@crg.es