Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST458391
Clone ID OST458391
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST458391
Sequence
GATGAAAAGAGGCTACTGGCTCCAGGGTTGAAGGTTCGTAAAGGCCTCTGGGATTACCCTCTGAAGAACCAGCAGATGGA
ATGCCGGAGTGACTGAAAAAAATGGGTGCTAATGCATCTAACTATCCTCATTCATGTTCCCCAAGGGTAGGGGGAAATTC
ACAGGCCCAGCAGACTTTCATAGGAACATCTTCCTATTCTCAACAAGGCTATGGTTGTGAGTCAAAGTTGTATAGCCTTG
ACCATGGCCATGAGAAACCACAAGACAAAAAA
Sequence Type mRNA
Unitrap ID UNI16560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 104076819..104078492 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041702 (Btbd7) NM_172806 BTB (POZ) domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:1917858]

 
Come back to gene ENSMUSG00000041702


For any suggestions or comments, please send an email to unitrap@crg.es