Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14814B11
Clone ID IST14814B11
Vector VICTR76
Project tigm

Sequence tag IST14814B11BBF1
Sequence
GAGGGAACTGGTAATGAAGACCAGGGTGCAAGTCAGTGTGTTCTTTAAGCTGCCCCTGTGGAGGAGAGGCAGAGGAGAGA
GAAATAGGAGCCCCTCTGTGTCTGCATGAAAGTCTAGAAACACAAGAGCCTTATTAACAAAACAAACCACCACCCACCAC
CACAAAAAAAAAANNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29419756..29419928 173
NO GENE  


Sequence tag IST14814B11HMR1
Sequence
GTTCCNGTAGCCNCAGCACTCAAATTTTAAATGTAATTTTCCTTACTCTAGCAGCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003871..97003929 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es