Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST458360
Clone ID OST458360
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST458360
Sequence
GATTGAGCTATCCATGTATATGTATATAGAATTTAACCCCCTCCACATCGTATGGTCAGACTGAAGAAGACATAACCAAC
AATCGTCTGAATTCTGACTGACTCACTGATAGTCCCAGGGGAAAATTAGAGGTCACTACTCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16561

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108836617..108836761 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071180 (2810008M24Rik) NM_001048250 RIKEN cDNA 2810008M24 gene Gene [Source:MGI Symbol;Acc:MGI:1922866]

 
Come back to gene ENSMUSG00000071180


For any suggestions or comments, please send an email to unitrap@crg.es