Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14538C6
Clone ID IST14538C6
Vector VICTR74
Project tigm

Sequence tag IST14538C6HMF1
Sequence
GCTCATTTTCNNGATTCTGGTTCTAAAACTGTGCGGCCAGACGCAAAGCCTGAGAAGCTGCCAGAAGCCAGCTAGCTCTA
CTCTCCATGGGACAGTCTCCTTCAGTAAAGCTATTCTGGACAATGTAACCTTTTCTCTACACACTGAACTTATGTGCCCA
ATCCATTTCTCATCATTCAGGGAAAAATAAAAGGAAACAAAAGAAACTTTTTAAAATACAAATGTTACTCAGATTCACAA
AAGTCTCTTAAAACTGAATTATCATGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114309626..114309897 268
 
EST/CDNA Est Name
  AA002285.1 - AA123499.1 - AA140438.1 - AA667223.1 - AI316270.1


Sequence tag IST14538C6HMR1
Sequence
GANCCNGTCTTCCAACAGCTCCCACAGAACACTCCAGGGGAAATTCCATTATCCCAGAAAGGAATCCTGCACCCTTTGCT
CTATTAGTCAGCTTTTATCGCTGTGGCATACCTGAGANAAATAGCCCCAAGGAGGAAAGGTTTATTANCTAAAAAATTGT
TTTACGTTTATATGTTTTGTGTGTGTGCTCAGGGGTGATAGATGTGTTCTTTCTTTACACCGTCTAGTTTCTCTTGCTTT
ATCTCTTGCTGGCCCTTTCCTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114309363..114309622 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es