Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10979E5
Clone ID IST10979E5
Vector VICTR76
Project tigm

Sequence tag IST10979E5BBF1
Sequence
AATGGAGATAGGTGACAGGANAAAATCTTTTTACTTTTCCTTTCTACCTTTCTTTTGCCTTTTCAAGTCTGGGTCTCTCT
GTGTGACCCTGAGTGTCCTAGTGCTTGTTCTGTANACCAGGCTGTCCTCAAACTCAAACATATCTGCCTGTTCTGCCTCC
CGAGTCCTGGGATTGAANGGGTATACCNCCNATGCCCACCTNTTTAANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70325567..70325779 199
 
EST/CDNA Est Name
  CA883725.1


Sequence tag IST10979E5HMR1
Sequence
CATTTACCCTCTTACTCATCATTAAAGTGATAGACC
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70325536..70325570 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es