Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631A4
Clone ID IST14631A4
Vector VICTR74
Project tigm

Sequence tag IST14631A4BBF1
Sequence
AGCACAGCGACACCCACACACACACGCCCACATACACATCACTCATACCGTTNACCCTTTCCCCCCTCATTCACTAAGAA
GGGAGGCAGANAGGGAGGAAAGGAGCGGANAGACTTCCCAAAGTAATCACCAAGAACCCTTAAAGTCTTTTACCACTTCT
AACTGAAAGTGAAGGGCATGGAGACCAGATTCTGAGGAAATGCCGTCAACTAGCACACCAAAGCAATCTTGGGGGAAATT
CCACCTTCCTTTGGAAACAGAATCTCGTGTAGTAAATAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41202768..41203051 278
 
EST/CDNA Est Name
  BY200140.1 - CJ174576.1 - BY005478.1 - BY208436.1


Sequence tag IST14631A4HMF1
Sequence
AGCACAGCGACACCCACACACACACGCCCACATACACATCACTCATACCGTTCACCCTTTCCCCCCTCATTCACTAAGAA
GGGAGGCAGAGAGGGAGGAAAGGAGCGGAGAGACTTCCCAAAGTAATCACCAAGAACCCTTAAAGTCTTTTACCACTTCT
AACTGAAAGTGAAGGGCATGGAGACCAGATTCTGANGAAATGCCGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41202768..41202974 205
NO GENE  


Sequence tag IST14631A4HMR1
Sequence
TGCTCAAGTGGATGTGTGTGCTCGAGTGCATGTACCATGGCATTTATGTGCAGAGCAGAGATTTGAAGTTGGTTTTATAC
TATAGGGATCTTTTACACTATATGGATCCTGGTGACTGAACTCAGAACTTCAGGCTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41202632..41202771 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es