Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST458243
Clone ID OST458243
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST458243
Sequence
GTTTGAGGTACTCTGATGCCATTTGAGGAGTNCCGGTCACACGAGTCCCTGCTCAGCCCCAGCAGCNTNGTGGAGGCCCT
GGACCTCAGCATGGAGGAGGAGGNGATTATCAAGCCCGTTCACAGCAGCATCCTGGGTCAGGACTACTGCTTCGAGGTGA
CAACATCATCAGGAAGCAAGTGTTTTTCCTGCCGGTCAGCCGCTGAGCGCGATAAGTGGATGGAGAACCTGAGGCGAGCA
GTGCACCCCAACAAGGACAACAGCCGGCGTGTGGAGCATATCCTGAAGCTGTGGGTGATTGAGGCCAAGGATCTGCCGGN
CAAGAAGAAGTATCTATGTGAACTGTGCCTGGACGATGTGCTGTATGCCCGTACCACAAGCAAGCTCAAGACGGACAATG
TCCTTCTGGNGAGAGCACTTTGAGTTCCATAACCTGCCGCCTNTACNCACAGCCACATGTGCACCTGTATCGGGAGACTG
Sequence Type mRNA
Unitrap ID UNI16569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35563174..35565560 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es