Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13399B8
Clone ID IST13399B8
Vector VICTR74
Project tigm

Sequence tag IST13399B8HMF1
Sequence
ACATGTGCAGTTTCCTGAAGGATGGAGGGAATCTTTGTAAACAGAGATCCACTTGCCAGGATAAAAATGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI21795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106354952..106355026 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042073 (Abhd14b) NM_029631 abhydrolase domain containing 14b Gene [Source:MGI Symbol;Acc:MGI:1923741]

 
Come back to gene ENSMUSG00000042073


For any suggestions or comments, please send an email to unitrap@crg.es