Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14198B4
Clone ID IST14198B4
Vector VICTR74
Project tigm

Sequence tag IST14198B4HMF1
Sequence
GTATACACGCTACACACAACAGACCTTGTCTTACAAGCGCTGACCTCCATATGAACACACACCTGCACACACATGAACGT
GAACCCATACAGAGAANAGGAAGGGCGAGGCAGAGAAGGAAACAGGAGGGGAAGGGGAGAGAGGTCTTTGAGACAGGATC
TTACTATGTAGCCCCAGCTGGCCTGGAACTCATTATGTATCTCATGCTGACTTTGAACATATGATCCTTTTGCTTCTACC
TCCTAAGTGCTAGGACTGTAGTCATGTGCCACAGTGCTCAGCAGGAAAAACAAAAAATAAAAAACTTCTCGAATCATTGT
TC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14167544..14167864 319
NO GENE  


Sequence tag IST14198B4HMR1
Sequence
NNAGCTAGCTGGCTCATGANCTTCTGAGGAACCTGNCTCTGTCTCTTGTANTGATGTTTTTACAGCCAAAAAGTAGTGTT
GGTTTTGTCTTGAAGAGTGATTTTTGTGTGTATACACGTGTGGACACCCATGAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI11950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14167867..14168002 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022678 (Nde1) NP_001107557 nuclear distribution gene E homolog 1 (A nidulans) Gene [Source:MGI (curated);Acc:Nde1-006]

 
Come back to gene ENSMUSG00000022678


For any suggestions or comments, please send an email to unitrap@crg.es