Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0741
Clone ID CH0741
Vector pGT0lxr
Project sanger

Sequence tag CH0741
Sequence
CATGACGTTTTGCAAAGCCTTGATCTTACTGAGAAACAAGATTCTCATCAATCCATCAAGTTTGCTAGAGCTCTTCTTTG
AGCTGCTGCGCTGCCACGACAAGCTCCTGCGGAAGACTCTGTACACACACATTGTGACTGATATCAAGAACATCAACGCC
AAACACAAGAACAACAAAGTGAACGTGGTGCTGCAGAACTTCATGTACACCATGTTGAGAGACAGCAATGCAACCGCAGC
CAAGATGTCCTTGGATGTGATGATCGAACTCTACAGAAGGAAACATTGGAAATGATGCCAAAACTGTCAATGTTATCACA
ACTGCGTGTTTTTCCAAGTTCACCAAGATATTGGTTGCTGCTTTGACGTCTCTTCCTCGGGAAAGATGAGGAAGAGAAGC
AGGACAGTGACTCAGAAATCCGAG
Sequence Type mRNA
Unitrap ID UNI3105

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92730838..92734110 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029415 (Sdad1) NM_172713 SDA1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2140779]

 
Come back to gene ENSMUSG00000029415


For any suggestions or comments, please send an email to unitrap@crg.es