Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14924C5
Clone ID IST14924C5
Vector VICTR76
Project tigm

Sequence tag IST14924C5HMF1
Sequence
GTCCCAATTATTATTATTATTCCTACTAATGCTATTATTATTTTGTGTGTGTGTGTTAGAGAGTCTGTCTTGTCTCTGTT
GTGCTGCCCTCCAGGCCGGCTGGCACTGGAGCTTCCAAGCACTTCTCTCCTGTTTCTGCCTTCCATCTCACAGGGCCTGT
TGGGGTCCCGGATGTAATTAAAGTCTTTTTTAATTTAGGTTGCAGAGACCTAACCCAGGCTTGCTTTTCNTTAAAGCCAT
CTTGCAGCTCANGTCACTTTTTACTTCTCTTGTTTTTTAATTTTAANCACANTTTCATTCTGTANCNAANNCTGTNCNGG
AACTTANTNTGTANCCNAGGNNGNCTTTNNCNNGTNANAATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14924C5HMR1
Sequence
GGACTTTCTTTGTTTTGTTTTGTTTCTGTTTTTTAAGATAGGGTCTCGCCGGACATGGTGGCGCACGCCTTTAATGCCAG
CACTCGGGAGGCANAGGCAGGTGAATTTCTGAGTTCAAGGCCAGGCTGGTCTACAGAGTGAGTTCCAAGACAGCCAGGGC
TACACAGAGAAACCCTGTCTCGAAAAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6067200..6067388 187
NO GENE  


Sequence tag IST14924C5BBF1
Sequence
GTCCCAATTATTATTATTATTCCTACTAATGCTATTATTATTTTGTGTGTGTGTGTTAGAGAGTCTGTCTTGTCTCTGTT
GTGCTGCCCTCCAGGCCGGCTGGCACTGGAGCTTCCNAGCNCTTCTCTCCTGTTTCTGCCTTCCATCTCNCAGGGCCTGT
TGGGGTCCCGGAN
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6067032..6067203 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es