Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST457861
Clone ID OST457861
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST457861
Sequence
GTCGTCAATGCAAGCTTCCCCCACCCCGTCTTCCACCCATGTGTGTCAACCCTGCCCCTGGAGGGACCATCACTCGAGTA
GGTGGGTTATNGGTAATGCCCTGGCACTTTANAGGCATNACATGGAACTTCTGCCCTTATNAANGAGCTGNGAGCTTGTC
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACTANTCANCAACCANCCATC
CANCCNTNCCAANCAAACAAANGGGCTGGANCAGATGNCTCANNGNNTANGAGCANTGACTGNTTCTTCTGAAGGACCTG
ANTCANAAAANCCAAGCAACCACAATGG
Sequence Type mRNA
Unitrap ID UNI16336

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110009903..110011605 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es