Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11632D12
Clone ID IST11632D12
Vector VICTR76
Project tigm

Sequence tag IST11632D12BBF1
Sequence
GGCTGAAGAGCANCGTCCCAGGGAGCAGCGGGAANAGGCTGNNCCCAANAATGTCCACCCCCCCACCCCGGCCAGGCGAG
GTGTGGCACTGACAGGTGGTCCCCGAGTGTGAAGCACTTGGCTCTCCGCACAGGGCCATCGGGCCGCGTGCCCTACCTGT
CGCCGGCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140864946..140865117 162


Sequence tag IST11632D12HMR1
Sequence
GCCCTCCGTTAGCGAGCGGCCGTGTGGAGTTGCACCTGGGTCTTTTCTGACCCCACTTTGGAGACGTGGTCTAGAGAGTG
GTTTATATTCATGTGTGACCATGTCCAGGGAAAGGGATGTGTCTTTGGTATCANACTCTTTTTCCTGGGGTCCCCGGCTT
TGTGGACTGTGGGGACGCATCCNNGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140864760..140864948 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es