Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15105F6
Clone ID IST15105F6
Vector VICTR80
Project tigm

Sequence tag IST15105F6BBF1
Sequence
ATCACAACAGTAGCCAACTTATAAAGTAGCAACAAGAATAATTCTACAGTTGCAGCATTAGAAAGGTTAGGAACCACTAC
TCTAAACAGAGAGGTTGAGAAAGGATAGACAGCATTGGAACTAGGAAGGCAGAGACTCCGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40129769..40129914 146
NO GENE  


Sequence tag IST15105F6HMR1
Sequence
GTGATTTGTAATGTAAATATCTGATATGTAGGCCATCGCTATGTGACCCCTGTGAAAGGGTCACTTGACCCCCAAAGGGG
TCTCAGCCTACAGGTTGAGAACCACAAGCATAGCACCCTTTCTCCTTAGCTGTCTTTTCAGTTGTCTCCTTCTTTTACTT
AACTCTTTCCTTCTAACCAGGGTCCATAAGGTCTGCTCTGGCTATTTGGCCCTCAAGGTCTGAGTAGCTGTCTGCAAATG
CTTGGCTTTGATCCTGTGTCTCCTTTGTATGGAAGGTGGGGCACAGTTCTTGGGGAACTCACATTGGGCAGACCTCAACT
TCTCCAGGCTATCGTTCCAGCTTCTCTGTGACCAGCACATTGGAAACTCCCATGTTTGCTGTTGGTTGCATCAGANAAGT
TGCCGAATAGATGGGTTCCTTGGAGGAGAGCTGTCTCATAAGAAATCCCTAGTCTATTCNGTCTCAGANTTCATATTTNA
CCNNNNCTGTGATGCCCTTGGCACCTCCCCTTCCCCGCCTCCACTGANAGCCCTGGCCNGCT
Sequence Type genomic DNA
Unitrap ID UNI35871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40129233..40129773 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]


Sequence tag IST15105F6HMF1
Sequence
ATCNCAACAGTAGCCAACTTATAAAGTAGCAACAAGAATAATTCTACAGTTGCAGCATTAGAAAGGTTAGGAACCACTAC
TCTAAACAGAGAGGTTGAGAAAGGATAGACAGCATTGGAACTAGGAAGGCAGAGACTCCGAGATCTTCGAAATAATTGAA
GCAGCTCCCTTGCCTACCCTATAACCCTCCCAGATAACCTACCCTATCAGGAAGGTCTTGAGCTGGTGCATCATGGGTAA
TGGTCTTTTGTCTTATAAGCCTTGGTAATTTCCTGTGCTTAAACTTTGGCATATTNAAAAATAACCCCAGTGATGACGCA
NAATACACATTCTTGGGTCTCAGAGCCAGACACACCAATTAAGANGANCATNANAGTCATTGTTNNGGTAAATAGAGGAN
AAAGAATCCCTGANTNAAGGGGTCTTCTAACACTCTCCTCTTTCCATCTTGAAGGACANCTGCCTTNCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40129769..40130233 438
 
EST/CDNA Est Name
  BY610002.1 - BY290330.1 - CD549864.1

 
Come back to gene BY610002.1 - BY290330.1 - CD549864.1


For any suggestions or comments, please send an email to unitrap@crg.es