Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14508H12
Clone ID IST14508H12
Vector VICTR74
Project tigm

Sequence tag IST14508H12HMF1
Sequence
GTTACCCCTGTCAAAGGATGAGCTCACCACAGTGACAGAGCTTCCCTCCACCTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 69789051..69789109 59
NO GENE  


Sequence tag IST14508H12HMR1
Sequence
GAACTCTTTTCTTATAAACATTGTGGATACATAGTTTATATAGTAAATATTATCAGTCTTTATTACGTGACATTAAAAAT
TTGTTTATGCTATGTTTTTATGTCTGTCTTACATTTTTGCAGTTATTTCTGTCATTCTGCTTTATAGTCTTGGGTTTATG
TATTTGTTTTACTTACATANAAGGCCTCTTCTGCAANAATAAAAATTATTTAGTGTTGTGTTGGTTTGAATGAGAATGGT
ACCCANAGACTCGATATTTGAATACTTGGTCCCCTGTTGGANAAACTGTTTGAGAAGGGTTGGGAAATGTGGCCTTGTTG
GAGGAGGTATGTCNCTGGNGATGGACNTTNANGTAN
Sequence Type genomic DNA
Unitrap ID UNI11930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59592355..59592709 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051705 (Senp8) NM_027838 SUMO/sentrin specific peptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1918849]

 
Come back to gene ENSMUSG00000051705


For any suggestions or comments, please send an email to unitrap@crg.es