Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10458D6
Clone ID IST10458D6
Vector VICTR76
Project tigm

Sequence tag IST10458D6BBF1
Sequence
ATCTCCAAAGTTAGGAAAGTGAGTGAGATATGGTTAGTACCTGAAAGGGACAATTANTCTANTCCAATGTCTCCATTCAT
TCATTCATTCATAAGCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4799773..4799875 99
NO GENE  


Sequence tag IST10458D6HMR1
Sequence
GTAATATGGTATTAGGTGATGGCTAGGTTTTGTTTTGTTTTGTTTTTAACTACATTTGTTTTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGNNNGTGTN
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4799884..4799981 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es