Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14506A10
Clone ID IST14506A10
Vector VICTR74
Project tigm

Sequence tag IST14506A10HMF1
Sequence
GCTATAGCCCGTCAGGCTACTCAGAACAGCGTGGAGCACTCTGAGCTCCTTCTAAAGCCCTTCAGCTCANCCGCGGCTTC
CTGTGCCTGCGAACAATGCTGCTGCGTCACCCACATGCAGCTCCCAGAAATGCTTTGCAACGGAAGATGGCAGGAGGGGG
AGCGCAGCTCGAGCGAGCNNNCNNNGCNNAGGGCCTGGCCGTTCTGCTGCAGCACCCAGAGGGGAGGTGTTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4333820..4334052 215
 
EST/CDNA Est Name
  AW912022.1 - AA473012.1 - BY272589.1 - BQ931182.1 - BU511036.1 - CF530791.1 - CN460078.1 - CN534456.1 - CD348471.1


Sequence tag IST14506A10HMR1
Sequence
GCAGGACTGCCCTACCTTACATGCTCTGGGAGATTCGGGATTTTCACGAAAATCAGGATTTTCCTAGAAGCAGAAAAGCT
AACTCCTTCCGCACAACTTCAACACAGAAAACAAAACAAAGGCGCTGGGGAAACTTCACCCAAGAGCCTCCGCAGCTCCA
GAGCAACAAGAAATGCAAGGTCAGGCGGTCGGTTGGCAAGCCTTTTCTGGTTTGGGGTGTGTATAACTGTAGAGACTTTG
TCTCTAGCNNANNGCNNANCTGCCTGCTGGGCNAGTCCAGGACAATGCGTGTGTTAGTTGTGTTN
Sequence Type genomic DNA
Unitrap ID UNI13020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4333518..4333821 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]

 
Come back to gene ENSMUSG00000054611


For any suggestions or comments, please send an email to unitrap@crg.es