Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11566H3
Clone ID IST11566H3
Vector VICTR76
Project tigm

Sequence tag IST11566H3BBF1
Sequence
CTGATGACCCTCCAAAGAAATCTCANGGGAAGAAAACTGTTCTANCCCACGGANTGAACATATTTGGGTTTTTCATGATN
ACCAAGAAGTCTACTAATTTAATACATTAAACTTGCNNGACATACNCAGAACCTCATGCTACANCCTTCCCCTACTTTTC
AAAAGTTTGGAATGNNNNNTACTANCCTTAAAGAANAGGGATTATTTTTCCTTTCTGGGTTACCAATACCCTAAACGGCT
TCTCTANCAACCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11566H3HMR1
Sequence
NCNGGCAAAAGTTTTCCCTCACTGCCTTGTACTTGATGACCCGAACCCTTGGTCTTCATCTCCTGAAAGAATTTTTCAAC
ACTAGCCTCACTTTACCTGGTGACCTT
Sequence Type genomic DNA
Unitrap ID UNI29773

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100115194..100115297 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041632 (Mrps27) NM_173757 mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]

 
Come back to gene ENSMUSG00000041632


For any suggestions or comments, please send an email to unitrap@crg.es