Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13119H1
Clone ID IST13119H1
Vector VICTR76
Project tigm

Sequence tag IST13119H1BBF1
Sequence
NCANCTGCCTTTGTTACTGANCCNTCCTACAGGCCCAANATGGTGCTTTTTTGAAACAGGGTCNCACTATGTANCTCTGA
CTGGCCTGGAANTCTCCATGTGGACCAGGCTGCCTTGCCGTCTTAAAACTCACTGTACCTATGTTCCTGTTGGGATACCA
GGANTGTACTACTATTTCCTCTGTTTTTGGTTTTGTTGTTATTATTGGGTTTTNTTTTNNACTTNNANTTTNNNTTNCNG
GG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13119H1HMF1
Sequence
GCAACTGCCTTTGTTACTGATCCATCCTACAGGCCCAAGATGGTGCTTTTTTGAAACAGGGTCTCACTATGTANCTCTGA
CTGGCCTGGAAGTCTCCATGTGGACCAGGCTGCCTTGCCGTCTTANAACTCACTGTANCTATGTTCCTGTTGGGATACCA
GGAGTGTACTACTATTTCCTCTGTTTTTGGTTTTGTTGTTATTATTGGGTTTTGTTTTTGACTTTTATTTTNNNTTNCNG
GN
Sequence Type genomic DNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3168579..3168809 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]

 
Come back to gene ENSMUSG00000054753


For any suggestions or comments, please send an email to unitrap@crg.es