Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059C8
Clone ID IST15059C8
Vector VICTR80
Project tigm

Sequence tag IST15059C8HMF1
Sequence
GGCACTAAAACCCCATCGTCCAAAGCAATCCAGTCAGGCACCACTGACCAGGGTATTTGCCTATACTCAAATGACACAGC
TCCAGGTCACTGGTCCTTAAAAGCCAGACGTGTCTGTCAGGGTTCTGCAGCTTCTAGGTCCTGGAGGTGACAGTACCTAC
ACAGTCACCTCGATTCTAGGCACATATTATCTCAATTAAGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108637909..108638114 206
 
EST/CDNA Est Name
  AA518167.1


Sequence tag IST15059C8BBF1
Sequence
CAANNCAATCCANTCAGGCACCACTGACCAGGGTATTTGCCTATACTCAAATGACACAGCTCCAGGTCACTGGTCCTTAA
AAGCCAGACGTGTCTGTCAGGGTTCTGCAGCTTCTAGGTCCTGGAGGTGACAGTACCTACACAGTCACCTCGATTCTAGG
CACATATTATCTCAATTAAGGTTAACTGAGACCCAGGGGAGTTATGTAACTTCCTCAAAGGTCACAAAGGAGTCAAAAGA
GAATGAGAATTCAAACCCAGGCCTGTGGAACTACAAAGCAAGGGTTCATTTTTCTCATCACAGAGCTGCTGTGAAGTGAG
TGCCAGGCTTTCCTTANTCACTGTCATCTANTACAGGTGCCTGAAGACACAAGTGACCCAAGCATGTCCTCCATCTCTGG
AAAATCCTTGAAAAGCAAGAAAGTGTCTCCCGTCGTTTGAGANGCANAGCATAATACAATTTCCTTTCNTGACCNANTGN
AACNNNGTGTGCNCNNGACAGTNNANTTTGNNANGNTGAGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15059C8HMR1
Sequence
TTNNNTGCCGTTTGTGCAGGCTCAAGGAANAGCTTTCCTCAAAGCCACACTTTCTATCAGGCAGTGGTAAGAGATAGAGA
GCCTCCGAGGCGCTGTTGCCGGGCGGTGGAACATGGCTGAAGATAGAACACACTAAGCCTGCTCTGCACTTATTTATGCA
TTGCATACTAATTAGGAGCGCACTTTGGTGCTTGGCAGTTGTGAGAAGTTGATGCCTATCTGTCCCTGCGATGCTGTTTC
TTGTGAGTACTGGGGAAGCACAGACCTCAGCGACCCCTGGCTTATCCCCATGCCTCCATGGACGGTTTTCTTCTGGCTTC
TCAGTGATTTTCCTTTGCCACCGTTCCTTGGCAAGTCTCCCTATTCTCTGTTTAAACAAGGATTAAAACATACTTCCTTT
AGCTGCTCCGTGGCCGTGCTGCATGGGCGGGAGCTGAGTGTAAAGCCTTTCGGANCAGGTGTGGAACAGTGAATGGTCTT
TAATTTCATTTTTTTAAAATTTACATTTTTAACCTCTTTTGCNACAAATGGCGGGGCACCATGGCCN
Sequence Type genomic DNA
Unitrap ID UNI400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108637372..108637912 535
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]

 
Come back to gene ENSMUSG00000032846


For any suggestions or comments, please send an email to unitrap@crg.es