Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13749E3
Clone ID IST13749E3
Vector VICTR74
Project tigm

Sequence tag IST13749E3BBF1
Sequence
GTGCCCAGACCTGTGGACCCTANAACCAGTTTGGCTGGACTTCTGTCTCTGTCCAGCCATTACGGGGCCATTTTCTGGGG
AGGGTATGCATTCCCAGGAACTGGCCCCAGGGAAAAGCTCTAGTGCATGTCTGACTGCAGTAGCCAGGCTGGANAACCAG
TGTGATAACCTCTCTCTGAACTGGCACTGACCCCTGTGCCTGACTTTGTCACATTTCCTAANAGGTTCCTTCTTTTGCAN
CATAGAGAACCCTTCAAGAAAAGATGGTTTGCCTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI22659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79989318..79989597 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]


Sequence tag IST13749E3HMF1
Sequence
GTGCCCANACCTGTGGACCCTANAACCAGTTTGGCTGGACTTCTGTCTCTGTCCAGCCATTACGGGGCCATTTTCTGGGG
AGGGTATGCNTTCNNNNGANCTGGCCCCAGGGAAAAGCTCTAGTGCATGTCTGACTGCANTACCCAGGCTGGAGAACCAG
TGTGATAACCTCTCTCTGAACTGGCACTGACCCCTGTGCCTGACTTTGTCNCATTTCCTAAGAGGTTCCTTCTTTTGCAN
CATANNGAACCCTTCANGAAAAGATGGTTTGCCTTGNATCCNCANGANCGGAGGCTGCTCTATTATNNNANCCNCNNGNT
NNNAGTCANTCNNGATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es