Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14183D2
Clone ID IST14183D2
Vector VICTR74
Project tigm

Sequence tag IST14183D2HMF1
Sequence
GTACCTAATGCAATGCTAAGCACTGGGCTCTCCTTCCNAGGCTCACTATGTAGGCAAGGTGGCCTCCACCTCANANNAAC
CCGCCTTTGCTACCCAGTGCCCCAGTGGCCCACCACACCCAGCCCTTTTGACCTTTGTTCAAGCCCTTCTCTCTACCTCC
ACTCATAAAAGGTTTANCCTAATTCTAATAACCTCTAATCAAAAGATCCAATTAATATTGCTCAATAGCAATTTACGGGT
TNACTGGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29142389..29142638 238
 
EST/CDNA Est Name
  BY028778.1 - BY173763.1 - BY788050.1 - BY789770.1 - BE375812.1 - BY053506.1 - BY325065.1 - BY064223.1 - BY058419.1 - BY785030.1 - BY326873.1 - BY139668.1 - CJ077433.1 - BQ877460.1 - CJ077352.1 - CJ074773.1 - BY768786.1 - BY209495.1 - CJ075002.1 - BY057134


Sequence tag IST14183D2HMR1
Sequence
CTGGCTGAANAATAAAAGGATTCTGCTGGCCTGTTATATTTGACATCTGCGAGCGCACATAATATCCCATTGACCTTTTA
GTTCTTTCAAGATAGATTCTCACTATATAGCTCTGGCTATCCTGGAATTCACTATGTAGACCAGGCTGCCCTCAAATTCA
CAGATCTGCATGCCTCTGCCTCTGGAGTGCTGTGATTAAAGATGTGTGCCATTATGCCCGGTTTCCTGTGGATCTTTTTA
TTGATTGATTGATTGGTTGGTTN
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29142128..29142389 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es