Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10936H2
Clone ID IST10936H2
Vector VICTR76
Project tigm

Sequence tag IST10936H2BBF1
Sequence
CCACCCGGTCCCCAGANAGGAAATTATCACTATGCAGAGCTTCCACAGCAAAACACAAACACCTGGTTGCCTGGGCAGCA
CCTTGCCAGGGTGACAAGATCCAGATGGTCCCTTGANAGATAGTAGGGTTGCCACGGAAACAGAATCGCTGCCGCTCTAG
CCGAGAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26413433..26413604 168
NO GENE  


Sequence tag IST10936H2HMR1
Sequence
GTGGCGGCNNGGCAGGTGGCTGGAAGGGAGCGGGGCCATCTTGGCTATGGCANTTGCCTTTGCTGCAACAACANAGCTCT
CTGGCCGATGGTTTGTCATTCACAGATGCCTCATTACCTTCCCAGGGACATGGTGGTTTGTTGAGGCTGGCA
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26413601..26413751 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es