Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14928B3
Clone ID IST14928B3
Vector VICTR76
Project tigm

Sequence tag IST14928B3HMR1
Sequence
NTATAATAATTGGATTGTGTGTTTTTATATGGGCTTATTGGAGTTGGAAATTCCAGCAACAAACTGAGTTTATTGTTTTT
GAAGCATGTTATCCAGCTCTCTGGCAATGAAGTGCAGACTGCTAACTCTCCAAGCCATAGCTAGGAGTTATTGCTTTGTT
ACTGGGGTCCTCTTTGAAGCATTTTGTTCTACTATCTAAATGCANCTTTTGGGAAAAAATTAAAAT
Sequence Type genomic DNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856528..164856752 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]


Sequence tag IST14928B3BBF1
Sequence
GTAGAGGCCCAGGTTTGCTGCCTAGCATGCACATGGAGCTCACATCTGTAACTACAGTATAGAAATCTGATGCCCTCTTC
TGGCCTCCACAGGCACCATGTGTGCATGTGATACATTTACATTTTTGGGCAAAATGTTCATATAAAAATAAAACCTCTAG
GCCGGGTGGTGGTGGTACACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGGAGGTGGATTCCTGAGTTCGAGGCCAGCC
TGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAAACAAAACAAAAAACTGAAA
AAATATAAAACCTCTAAAAAAACCTTACTTTTANTTTATGTGTATATTTTGCCTTCATGTAAGTGCACTGTGTGTGTGTG
TGTTTATGTATGTATGTATGTGTGTGNGCACGTGNGNNNNNNTCATAGGGACTANAANNNGATGNNGNATNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103260503..103260966 438
 
EST/CDNA Est Name
  BB643212.1 - BY749033.1 - BB855466.1 - BB851752.1 - BB663556.1 - BB855352.1 - BE533439.1 - BB853092.1 - BY730279.1 - BB852502.1 - CJ098509.1 - BP761742.1 - CJ111953.1 - CJ109228.1 - BY201335.1 - CJ069634.1 - BY343386.1 - BB858088.1 - BY342937.1 - BY199470

 
Come back to gene BB643212.1 - BY749033.1 - BB855466.1 - BB851752.1 - BB663556.1 - BB855352.1 - BE533439.1 - BB853092.1 - BY730279.1 - BB852502.1 - CJ098509.1 - BP761742.1 - CJ111953.1 - CJ109228.1 - BY201335.1 - CJ069634.1 - BY343386.1 - BB858088.1 - BY342937.1 - BY199470


For any suggestions or comments, please send an email to unitrap@crg.es