Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12056B2
Clone ID IST12056B2
Vector VICTR76
Project tigm

Sequence tag IST12056B2HMF2
Sequence
CTGTCCATTGGTGAAAGTGGTGTGTTGAAGTCTCCCACTATTATTGTGTGAGGCGCAATGTGTGCTTTGAGCTTTACTAA
AGTTTCTTTAGTGAATGTGGCTGCTCTTGTATTTGGAGCATANATATTCANAATTGANAGTTCCTCTTGGAGGATTTTAC
CTTTGATGANAATGANNTGTCCCTCCTTGTCTTTTTTGATGACTN
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI29438 UNI32730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 49805..50008 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 135715..135918 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2532700..2532903 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 15335170..15335373 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10879504..10879707 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11184871..11185074 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19346070..19346273 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4620195..4620398 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5095508..5095711 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9688018..9688221 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7824797..7825000 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4769501..4769704 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3175073..3175276 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11094505..11094708 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055493 (Epm2a) NM_010146 epilepsy, progressive myoclonic epilepsy, type 2 gene alpha Gene [Source:MGI Symbol;Acc:MGI:1341085]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3911205..3911408 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3768789..3768992 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5108794..5108997 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3985596..3985799 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12884713..12884916 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055963 (OTTMUSG00000004461) NP_776107 predicted gene, OTTMUSG00000004461 Gene [Source:MGI Symbol;Acc:MGI:3650048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4168257..4168460 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4904696..4904899 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7841491..7841694 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13725025..13725228 192
NO GENE  


Sequence tag IST12056B2BBF1
Sequence
CAGGGTAGAAGGCTAGGGAGGATGAGGGAGGTCTCAGGGGAGGTCCCAGAGAGGATGGGCTGGGGATGGAGTGACNAGAG
ACCCCATAGCACAGCAGAGTCAGGATCTGCAGGGGAGGGGCTGCACAGAAGTAGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140895344..140895483 138
NO GENE  

 
Come back to gene ENSMUSG00000055963


For any suggestions or comments, please send an email to unitrap@crg.es