Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14480C6
Clone ID IST14480C6
Vector VICTR74
Project tigm

Sequence tag IST14480C6HMR1
Sequence
ATGGGAGGGAGTAAGTATGTGCATGATGTATTCAGAGGTCANAAGATAACTAGGAGTTCATTCTCTCCTTCCACCCGACA
TAGGTCATCAGACTTGAAGACAGGCACCTTTACCCCATAAGCCACTCAGCCACACACCCAACTCCATCTTTAGATCATTT
GCCTCTAAGAGCTCAAGACCATAAATGCAAAAANATATATAACTCCNATTTNNNNGANCTCCTGGGGGGGGTGGGGGAGG
GAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87332847..87333088 226
NO GENE  


Sequence tag IST14480C6HMF1
Sequence
CCATATAAATAAATNAATGTTTAAAAAATGATGGAGGTGGGGCCAGGCTAGCTTAGAGGTAGAACACAATGTTTAGTAGC
ATGTGTAAGGCCCTAGACTTAATCTCCAGAGCCAAGGGAAATTAATAATAATGATGATGATGATGATAGTGAGGGGCTGG
GTTTGTGTGGCACACATCTATACTTGCACTTCANAAGTGGAAGCAGGAAGGTTAANAAAGAGTTCAAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87333085..87333315 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]


Sequence tag IST14480C6BBF1
Sequence
CCATATAAATAAATCAATGTTTAAAAAATGATGGAGGTGGGGCCAGGCTAGCTTAGAGGTAGAACACAATGTTTAGTAGC
ATGTGTAAGGCCCTAGACTTAATCTCCAGAGCCAAGGGAAATTAATAATAATGATGATGATGATGATAGTGAGGGGCTGG
GTTTGTGTGGCACACATCTATACTTGCACTTCAGAAGTGGAAGCAGGAAGGTTAAGAAAGAGTTCAAAGTCAACCTCAGA
CACAAGAAGTTGGAAGCCAGCCTGGGATACATGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87333085..87333363 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es