Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12260A9
Clone ID IST12260A9
Vector VICTR76
Project tigm

Sequence tag IST12260A9HMF2
Sequence
CTAGGACCCGTGGCAATTGTGTGCCATCTACCAGGACCCATCATCTTAGGGTCCAAATGTTGTGACAGGCTATATTTCAG
TTGTCCTCTGGGGTCTCATGGCATTTACAGTTCCTCCCTTTAGGGGAACCAGCACAACAGGCCATTTCCCATTCCCTCCA
ATGGACTAGGGTGGAGCCAGCTGCCTCCTCTGATAATGTCACCCCACTCTGTCCCTTCTTAATGTGTCACTGCCTCATTC
CTGATCCGAATAGATACCTGGATCAGCTTCACCTACAGACTTGGCCTTGGCAAGCCTCCTTCCACTCACTGGTGAGTGCA
TCTTAACTCTTCTTGGATTACCACTGTCCCTTGCCCAGCCATCTGATCGGTGACAGGGTCATCTTGGTGACCTCTCCACA
GCAGCAGCAGANGGGGAGCTTCCN
Sequence Type genomic DNA
Unitrap ID UNI30653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4778403..4778825 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053550 (D430041B17Rik) NM_172737 RIKEN cDNA D430041B17 gene Gene [Source:MGI Symbol;Acc:MGI:3605641]


Sequence tag IST12260A9BBF1
Sequence
GCTTCACACAGCATACTGTTGTCGTCTCCCTAATACTTAATCCAAACTAGGCGGTGGTGGTTCACCTTTCATCTCAGAAC
TCAGGGGGCAGAGGCAGGTGGACCTCCAAGTTTGAGGCCAGCCTGGTCTACAGAACTAGTTCCAGGACAGCCAGAGCTGC
ACAGAAACCTGTCTTAAAACAACAAACAAACAAAGAAACAACAACAACAACAAGAGTTAATCCAATCCTGTCAATGACCT
GGCCAGGAGGCAGCTGAGGGAACGGGCAGAATGGTTATCTCATTAGTGAGGTGAAACCCTTGCAGCCCTCANANCTCTTC
CCTGANTCTCTGTGCACTATGGTTCTTAACTCANCCCTCAGANCTCTCCCTGATGCAGCTGCTTATGGTTCTTTCCCGAN
TCTGCGTGCACTATGAGTNAACTTGAAAGGCCCAACTCGTCCTTCTCTACCAGCCTTCTTGTCTCCATTTTTTTTNNNCC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4961804..4962278 461
 
EST/CDNA Est Name
  BE690390.1 - BF136585.1 - BM949311.1 - BI251395.1 - BB650646.1 - BI146423.1 - BU609308.1 - BU504265.1 - CA555860.1 - BY719640.1 - BG246160.1 - CF173232.1 - BX514734.1 - AW475264.1 - AI788429.1 - CA870701.1 - CF916228.1 - CK620966.1 - CA547909.1 - CD563788

 
Come back to gene BE690390.1 - BF136585.1 - BM949311.1 - BI251395.1 - BB650646.1 - BI146423.1 - BU609308.1 - BU504265.1 - CA555860.1 - BY719640.1 - BG246160.1 - CF173232.1 - BX514734.1 - AW475264.1 - AI788429.1 - CA870701.1 - CF916228.1 - CK620966.1 - CA547909.1 - CD563788


For any suggestions or comments, please send an email to unitrap@crg.es