Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14549C6
Clone ID IST14549C6
Vector VICTR74
Project tigm

Sequence tag IST14549C6HMR1
Sequence
NNGAAAGTCGGATTCTTTTCCTGGCTTTGTTCTTATAACNNTCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TNTNTGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14549C6BBF1
Sequence
TTGGGAAAGAATGCACATTCAGCATTAGCTAGAAATGGACTCGAGGAGATTAGCTGCGAATATTCACTGTTGCACTGTAT
GAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88214454..88214539 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050144 (Slc25a44) NP_848811 solute carrier family 25, member 44 Gene [Source:MGI Symbol;Acc:MGI:2444391]

 
Come back to gene ENSMUSG00000050144


For any suggestions or comments, please send an email to unitrap@crg.es