Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14874G7
Clone ID IST14874G7
Vector VICTR76
Project tigm

Sequence tag IST14874G7HMF2
Sequence
TTTGGAGGTTCCACCGAGATTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14874G7BBF1
Sequence
GTGGGAGTTGGGGGAGGACACAGGTCCTTCCTCCTATAAAGGAGCCTTGTGGTGTTTTGTTTTGTTTTGTTTTGTTTTTT
AAGATTTATTTATTTTATGTAAGTACACTGTAGCTGTCCTCAGATACTCCANAAGAGGGCATCANATTTTGTTACGGATG
GTTGTGANCCNCCATGTGNTTN
Sequence Type genomic DNA
Unitrap ID UNI33424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74356882..74357062 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026179 (Pnkd) NM_019999 paroxysmal nonkinesiogenic dyskinesia Gene [Source:MGI (curated);Acc:Pnkd-001]

 
Come back to gene ENSMUSG00000026179


For any suggestions or comments, please send an email to unitrap@crg.es