Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST456835
Clone ID OST456835
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST456835
Sequence
TCTGAGACTGGGAAGCACGCCTGAGCTAGANANATCTCGTGCTGCCAAGTGTCCAGACATTGCCATACAGCTGGCTGGGA
CTAAGAAGGTGCAGCAGGAACTGAGCAGGGTGGGTCTGCTGGAAGCACTGCTCCCGGGCCAGCCCGAGGCTGTGGCCCGC
CTCCGAGCCACCTTTGCTGGCCTCTATTCACTGGACATGGGTGAAGAAGGGGACCAGGCCATTGCTGAGGCCCTTGCTGC
TCCTAGCCACTTTGTGCTGAAGCCCCAGAGAGAGGGTGGAGGTAACAACTTATACGGGGAAGAAATGGTACAAGCTCTGG
AGCAGCTGAAGGACAGTGAGGAGAGAGCCTCCTACATCCTCATGGAGAAGATTGAACCTGAGCCTTTTAGGAATTGCTTG
CTACGGCCTGGCAGCCCTGCCCAAGTGGTCCAGTGTATCTCGGAGCTGGGTATTTTTGGAGTCTATGTCAGACAGGGAAC
AACACTGGTGATG
Sequence Type mRNA
Unitrap ID UNI16619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155389434..155393622 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027610 (Gss) NM_008180 glutathione synthetase Gene [Source:MGI (curated);Acc:Gss-001]

 
Come back to gene ENSMUSG00000027610


For any suggestions or comments, please send an email to unitrap@crg.es