Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15002B12
Clone ID IST15002B12
Vector VICTR78
Project tigm

Sequence tag IST15002B12BBF1
Sequence
CTTTGGGCTCTCTATCTACCAAGAAGAGCTTCCTCCACCACAGGCAATGCTCTGTCCAAGGAGGACACAGGAGCCCATGA
GCCAAAACAAAGCTTTCCTCACTGAGTCATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153248..104153359 112
NO GENE  


Sequence tag IST15002B12HMR1
Sequence
ATTTCTCCTTCCTTCCTCTGCGTTCCGTACTGCCTTAACCCCCAGCCCATGGGATGGTACCACCCACATTCAAGGCAGGT
CTTCCCTTCAGCTAATCCTATCTGTATGTATCTTCAAACACAGCCACAAATGGACCACAACAGCCCCTGGGTGGTTCTAN
ATCTNNGCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153379..104153551 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST15002B12HMF1
Sequence
TTTTGGGCTCTCTATCTACCAAGAAGAGCTTCCTCCACCACAGGCAATGCTCTGTCCAAGGAGGACACAGGAGCCCATGA
GCCAAAACAAAGCTTTCCTCACTGAGTCATCTCTGTCAGGTGTCTGGGCACTCAGGAGATGTTCCATGGGAAAAGGTGGC
CTCTAAGCTCCTGCAGAGATGCCACTGTCCCCTCCTACCCACCTGCCCCGCACTAGCTCAGAGCAGCGGCTGGTTTANAA
CAAGGCTGTGGGCCTGACTGTCACATCTGACTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153087..104153358 270
NO GENE  

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es