Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12738D1
Clone ID IST12738D1
Vector VICTR76
Project tigm

Sequence tag IST12738D1BBF1
Sequence
GGGTTGCAGTGTTCCTAAGGGAGGGCATCCAATTTTGATTTTGTTGCTGTTGTTGTTGTTTCNGN
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66545668..66545729 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST12738D1HMF1
Sequence
GAAGAATAGAAATAAAAATATTGAGGCCTTCTCTCTGTGATAATCAAAAGGTTTTAAATATACCAAAAAAGGGGGAAAAA
AAAGACTTAAAATAGTATTTTGAGGGTTCAGCTATTAGGAGCACGTGCTGCTCTTCCAAAGGACCANAGTTCAGTTCCCA
AAACCCACATCAGGCCGCCACAGCCTCTAACTCCAGCTCCACAGAATCCAACACTAACTTCTGACCTCTAAGGACCTGGT
GTACATGTGTGCATTCACATAGAGAGAGACACAGACATATACACATGATCTGAAATAAAATCTTTAAATAAAGCCTGGAG
TCTTTCAAAATAACACTATGTTAAAGATTTAATACCCTTAGTAATTTAATAGTTTTGGAATCTTTTTCCGTTTTNATCCT
ATTATTTAAAAGGGTAACCTAAAATAACTTGAAATAAATTGCCNAATATNATATTCTTATGCCAAATAACTTTAGNGTTN
ATCNTCNGNNATTTNAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71188965..71189462 468
 
EST/CDNA Est Name
  CA316878.1 - CV563121.1 - BG919080.1 - BI649238.1 - CX123714.1 - BY741168.1 - BE912090.1 - BY734667.1 - BB618078.1 - CJ092515.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301.1 - BF142058.1 - BB852770

 
Come back to gene CA316878.1 - CV563121.1 - BG919080.1 - BI649238.1 - CX123714.1 - BY741168.1 - BE912090.1 - BY734667.1 - BB618078.1 - CJ092515.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301.1 - BF142058.1 - BB852770


For any suggestions or comments, please send an email to unitrap@crg.es